Review
Similar Products
90
|
ATCC
mrna xm 002787768 1 1082 259652 perkinsus mediterraneus Mrna Xm 002787768 1 1082 259652 Perkinsus Mediterraneus, supplied by ATCC, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/result/mrna xm 002787768 1 1082 259652 perkinsus mediterraneus/product/ATCC Average 90 stars, based on 1 article reviews
mrna xm 002787768 1 1082 259652 perkinsus mediterraneus - by Bioz Stars,
2026-02
90/100 stars
|
Buy from Supplier |
90
|
Addgene inc
wild type human mybl2 construct Wild Type Human Mybl2 Construct, supplied by Addgene inc, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/result/wild type human mybl2 construct/product/Addgene inc Average 90 stars, based on 1 article reviews
wild type human mybl2 construct - by Bioz Stars,
2026-02
90/100 stars
|
Buy from Supplier |
90
|
Addgene inc
plasmid pcdna3 wt b myb  Plasmid Pcdna3 Wt B Myb, supplied by Addgene inc, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/result/plasmid pcdna3 wt b myb/product/Addgene inc Average 90 stars, based on 1 article reviews
plasmid pcdna3 wt b myb - by Bioz Stars,
2026-02
90/100 stars
|
Buy from Supplier |
90
|
ATCC
gggcgcttagctcagctgggagagcatctgccttacaagcagggggtcataggttcgagc cctatagtgcccacca clostridium thermocellum atcc 27405 chr Gggcgcttagctcagctgggagagcatctgccttacaagcagggggtcataggttcgagc Cctatagtgcccacca Clostridium Thermocellum Atcc 27405 Chr, supplied by ATCC, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/result/gggcgcttagctcagctgggagagcatctgccttacaagcagggggtcataggttcgagc cctatagtgcccacca clostridium thermocellum atcc 27405 chr/product/ATCC Average 90 stars, based on 1 article reviews
gggcgcttagctcagctgggagagcatctgccttacaagcagggggtcataggttcgagc cctatagtgcccacca clostridium thermocellum atcc 27405 chr - by Bioz Stars,
2026-02
90/100 stars
|
Buy from Supplier |
90
|
ATCC
bacillus subtilis pb6 yes no plant protection products bacillus subtilis rti477 efsa q 2019 00341 yes no Bacillus Subtilis Pb6 Yes No Plant Protection Products Bacillus Subtilis Rti477 Efsa Q 2019 00341 Yes No, supplied by ATCC, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/result/bacillus subtilis pb6 yes no plant protection products bacillus subtilis rti477 efsa q 2019 00341 yes no/product/ATCC Average 90 stars, based on 1 article reviews
bacillus subtilis pb6 yes no plant protection products bacillus subtilis rti477 efsa q 2019 00341 yes no - by Bioz Stars,
2026-02
90/100 stars
|
Buy from Supplier |
90
|
Thermo Fisher
calmodulin antagonist divemily 25965 Calmodulin Antagonist Divemily 25965, supplied by Thermo Fisher, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/result/calmodulin antagonist divemily 25965/product/Thermo Fisher Average 90 stars, based on 1 article reviews
calmodulin antagonist divemily 25965 - by Bioz Stars,
2026-02
90/100 stars
|
Buy from Supplier |
90
|
ATCC
25965 s aureus strain 25965 S Aureus Strain, supplied by ATCC, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/result/25965 s aureus strain/product/ATCC Average 90 stars, based on 1 article reviews
25965 s aureus strain - by Bioz Stars,
2026-02
90/100 stars
|
Buy from Supplier |
90
|
ATCC
staphylococcus aureus Staphylococcus Aureus, supplied by ATCC, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/result/staphylococcus aureus/product/ATCC Average 90 stars, based on 1 article reviews
staphylococcus aureus - by Bioz Stars,
2026-02
90/100 stars
|
Buy from Supplier |
Image Search Results
Journal: Cell
Article Title: Allosteric Activators of Protein Phosphatase 2A Display Broad Antitumor Activity Mediated by Dephosphorylation of MYBL2
doi: 10.1016/j.cell.2020.03.051
Figure Lengend Snippet: KEY RESOURCES TABLE
Article Snippet:
Techniques: Control, Western Blot, Immunohistochemistry, Flow Cytometry, Virus, Recombinant, Immunoprecipitation, IP Phosphatase Assay, Modification, Polymerization Assay, Fluorescence, Transgenic Assay, CRISPR, shRNA, Cloning, Plasmid Preparation, Selection, Software, Mutagenesis, Protease Inhibitor, Expressing, Cell Culture, Staining, Reporter Assay, Microscopy, Multiplex sample analysis, Protein Quantitation, Mass Spectrometry, Sample Prep, Phospho-proteomics